View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7341_low_13 (Length: 335)
Name: NF7341_low_13
Description: NF7341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7341_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 13 - 319
Target Start/End: Complemental strand, 39951646 - 39951341
Alignment:
| Q |
13 |
aatataccaaagaagtaggacagttagtagcctagaaaaatagcttaattagttgaacttcatgcaactggttacaatctcatgaattatgataccttag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39951646 |
aatataccaaagaagtaggacagttagtagcctagaaaaatagcttaattagttgaacttcatgcaactggttacaatctcatgaattatgataccttag |
39951547 |
T |
 |
| Q |
113 |
aattctccaaatcattcagtgaatagattattttaaagggggaaaagtctgataaaggacattgcttcagcctctggcaggtttggggcatcaaacaatt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39951546 |
aattctccaaatcattcagtgaatagattattttaaggggggaaa-gtctgataaaggatattgcttcagcctctggcaggtttggggcatcaaacaatt |
39951448 |
T |
 |
| Q |
213 |
tgtaaacgagctgttcacctttccccttcctgaacattagccttatggtggccgcatgagctagcacatgcccccctgctggtttcttcgatcagtatag |
312 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
39951447 |
tgtaaacgcgctgttcacctttccccttcctgaacattagccttatggtggccgcatgagctagcacatgcccccctgctggtttcttcgatcagtaatg |
39951348 |
T |
 |
| Q |
313 |
aagatac |
319 |
Q |
| |
|
||||||| |
|
|
| T |
39951347 |
aagatac |
39951341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 127 - 300
Target Start/End: Complemental strand, 46402907 - 46402735
Alignment:
| Q |
127 |
ttcagtgaatagattattttaaagggggaaaagtctgataaaggacattgcttcagcctctggcaggtttggggcatcaaacaatttgtaaacgagctgt |
226 |
Q |
| |
|
|||| |||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| |||| |||| | ||| |
|
|
| T |
46402907 |
ttcaatgaataaattattttaa-gggggaaaagtctgataaaggatattgcttcagcctctggcaggtttggggcgtcaaacactttgcaaacacgttgt |
46402809 |
T |
 |
| Q |
227 |
tcacctttccccttcctgaacattagccttatggtggccgcatgagctagcacatgcccccctgctggtttctt |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46402808 |
tcacctttccccttcctgaacatcagccttatggtggctgcatgagctagcacatgcccccctgctggtttctt |
46402735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University