View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7341_low_16 (Length: 275)
Name: NF7341_low_16
Description: NF7341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7341_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 6 - 257
Target Start/End: Complemental strand, 20567632 - 20567381
Alignment:
| Q |
6 |
agcatttccactaccaccattgtaatttctcaaagtttcccacattgacacttcaagccaattactagcattaccatttagacctaaatcctcacttcca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20567632 |
agcatttccactaccaccattgtaatttctcaaagtttcccacattgacacttcaagccaattactagcactaccatttagacctaaatcctcacttcca |
20567533 |
T |
|
| Q |
106 |
tgatgaccactcttaatactattactatctttcccaataccatttttaaaccttctagataattgagttttactactaccaccattattattactcactc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20567532 |
tgatgaccactcttaatactattactatctttcccaataccatttttaaaccttctagataattgagttttactactaccaccattattattactcactc |
20567433 |
T |
|
| Q |
206 |
taccaatttcaacaaatgtaccttgtaatggtgatgtattatacggtcgaaa |
257 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20567432 |
taccaatttcaacaaatgtaccttgcaatggtgatgtattatacggtcgaaa |
20567381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University