View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7341_low_27 (Length: 227)
Name: NF7341_low_27
Description: NF7341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7341_low_27 |
 | |
|
| [»] scaffold0565 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 7 - 136
Target Start/End: Complemental strand, 50608945 - 50608816
Alignment:
| Q |
7 |
ctctactccttctattttattcgaaaatgtgaaattaaattcttttatgtggattaaagctagacaagcgactttcacctaccgttatcatgattggtgt |
106 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
50608945 |
ctctactccttctgttttattcgaaaaggtgaaattaaattcttttatgtggattaaagctagacaagcgactttcacctataattatcatggttggtgt |
50608846 |
T |
|
| Q |
107 |
aagaatatgcttccttgcatgggagttctc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50608845 |
aagaatatgcttccttgcatgggagttctc |
50608816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 2 - 135
Target Start/End: Complemental strand, 17737921 - 17737788
Alignment:
| Q |
2 |
gtggcctctactccttctattttattcgaaaatgtgaaattaaattcttttatgtggattaaagctagacaagcgactttcacctaccgttatcatgatt |
101 |
Q |
| |
|
||||||||| ||||| |||||||||| |||||| | |||||||||| |||| ||||||||||||||||||| ||||||||||||| |||||||||| | |
|
|
| T |
17737921 |
gtggcctcttctcctactattttattagaaaatatcaaattaaattattttttgtggattaaagctagacagtcgactttcacctatagttatcatgaat |
17737822 |
T |
|
| Q |
102 |
ggtgtaagaatatgcttccttgcatgggagttct |
135 |
Q |
| |
|
|||||||| || ||| ||||||||||||||||| |
|
|
| T |
17737821 |
ggtgtaagcatccgctcccttgcatgggagttct |
17737788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 8 - 135
Target Start/End: Complemental strand, 10805 - 10678
Alignment:
| Q |
8 |
tctactccttctattttattcgaaaatgtgaaattaaattcttttatgtggattaaagctagacaagcgactttcacctaccgttatcatgattggtgta |
107 |
Q |
| |
|
|||||||| |||||||| | ||||| |||||| |||||| |||| | ||||||||||| | | | || ||||||||||| |||||||||||||||| | |
|
|
| T |
10805 |
tctactccaactattttaattgaaaaggtgaaactaaattattttctttggattaaagcaaaaaaggcaactttcacctatagttatcatgattggtgca |
10706 |
T |
|
| Q |
108 |
agaatatgcttccttgcatgggagttct |
135 |
Q |
| |
|
|| || ||| ||||| ||||||||||| |
|
|
| T |
10705 |
agcatccgctcccttgtatgggagttct |
10678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University