View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7341_low_7 (Length: 362)
Name: NF7341_low_7
Description: NF7341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7341_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 13 - 339
Target Start/End: Complemental strand, 20567955 - 20567629
Alignment:
| Q |
13 |
aatattgataatagtaaatagatttgggaagaacaacataccttcttggctctaccttgtccaataacaaacttatcaagacctttacaaatctcctttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20567955 |
aatattgataatagtaaatagatttgggaagaacaacataccttcttggctctaccttgtccaataacaaacttatcaagacctttacaaatctcctttg |
20567856 |
T |
 |
| Q |
113 |
gtgaaggcaaatccttccccaaattagaccctccccatgcattcttctcaccattacctccaccacccggaccaccctcctgcggtcccctagcccttat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
20567855 |
gtgaaggcaaatccttccccaaattagaccctccccatgtattcttctcaccattaccaccaccacccggaccaccctcctgcggccccctagcccttat |
20567756 |
T |
 |
| Q |
213 |
aacattaagccccggcgcaaaaggaggacctggaggagtatgcacagccaaaccattcccattaccaccacctaccggcagtggccatgtctccggcggc |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20567755 |
aacattaagccccggcgcaaaaggaggacctggaggagtatgcacagccaaaccattcccattaccaccacctaccggcagtggccatgtctccggcggc |
20567656 |
T |
 |
| Q |
313 |
tccccattattaccaccaccaccagca |
339 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
20567655 |
tccccattattaccaccaccagcagca |
20567629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 113
Target Start/End: Original strand, 41648031 - 41648092
Alignment:
| Q |
52 |
accttcttggctctaccttgtccaataacaaacttatcaagacctttacaaatctcctttgg |
113 |
Q |
| |
|
||||||||||| || |||||||||| ||| |||||||| |||||||||||||||||||| |
|
|
| T |
41648031 |
accttcttggccctttcttgtccaattacatgtttatcaagccctttacaaatctcctttgg |
41648092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University