View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7343_low_6 (Length: 289)
Name: NF7343_low_6
Description: NF7343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7343_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 16 - 273
Target Start/End: Complemental strand, 25093947 - 25093690
Alignment:
| Q |
16 |
atcttgtcattgggctttgtttgttcattacattaaaatatgtggttctcttcatatgacacttagtgttatttggtacatttctcagcacttggggagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
25093947 |
atcttgtcattgggctttgtttgttcattacattgaaatatgtggttctcttcatatgacacttggtgttatttggtacatttctcagcacttggggagg |
25093848 |
T |
|
| Q |
116 |
tcacttggaggtggtaatagagattcatttggtcctttaccattgtccacaacaaatgccatcttcagtccccatgttgtatgaatttccaaatgacaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25093847 |
tcacttggaggtggtaatagagattcatttggtcctttaccattgtccacaacaaatgccatcttcagtccccatgttgtatgaatttccaaatgacaat |
25093748 |
T |
|
| Q |
216 |
gcataaaccacacccctaacaaaatataataccatactttaattaccacaatacatat |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25093747 |
gcataaaccacacccctaacaaaatataataccatactttaattaccacaatacatat |
25093690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 104; Significance: 7e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 97 - 232
Target Start/End: Complemental strand, 29555376 - 29555241
Alignment:
| Q |
97 |
ttctcagcacttggggaggtcacttggaggtggtaatagagattcatttggtcctttaccattgtccacaacaaatgccatcttcagtccccatgttgta |
196 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
29555376 |
ttctcaacacttgggaaggtcacttggaggtggtagtaaagattcatttggtcctttaccattgtccacaacaaatgccatcttcaatccccaagttgtg |
29555277 |
T |
|
| Q |
197 |
tgaatttccaaatgacaatgcataaaccacacccct |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29555276 |
tgaatttccaaatgacaatgcataaaccatacccct |
29555241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 149 - 225
Target Start/End: Complemental strand, 4385061 - 4384985
Alignment:
| Q |
149 |
cctttaccattgtccacaacaaatgccatcttcagtccccatgttgtatgaatttccaaatgacaatgcataaacca |
225 |
Q |
| |
|
||||| ||||||||||| | ||| |||||||| || |||||||||||||| | |||||||| |||||||| ||||| |
|
|
| T |
4385061 |
cctttgccattgtccaccaaaaaggccatctttagaccccatgttgtatgcacctccaaatggcaatgcatgaacca |
4384985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 171 - 232
Target Start/End: Complemental strand, 21854762 - 21854701
Alignment:
| Q |
171 |
atgccatcttcagtccccatgttgtatgaatttccaaatgacaatgcataaaccacacccct |
232 |
Q |
| |
|
|||||||||| || ||||| |||| || |||||||| ||||||||||| |||||||||||| |
|
|
| T |
21854762 |
atgccatcttaagaccccaacttgtgtggatttccaagtgacaatgcatgaaccacacccct |
21854701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University