View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7345_high_10 (Length: 236)
Name: NF7345_high_10
Description: NF7345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7345_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 103 - 217
Target Start/End: Complemental strand, 21227559 - 21227445
Alignment:
| Q |
103 |
cctctttctaacctagcacttatgcacaagcttctaaatatgatcattggctacgccatagacactgcactacaagctcttcaattaaacagcatttgag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
21227559 |
cctctttctaacctagcacttatgcacaagattctaaatatgatcattggctaggccatagacactgaactacaagctcttcaattaaacaccatttgag |
21227460 |
T |
 |
| Q |
203 |
tgcttacttaagtca |
217 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21227459 |
tgcttacttaagtca |
21227445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University