View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7345_high_6 (Length: 258)
Name: NF7345_high_6
Description: NF7345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7345_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 85
Target Start/End: Complemental strand, 21946274 - 21946207
Alignment:
| Q |
18 |
aaacaaatgcctcagctccctcgtattgatcgatgatccaagtagatacaacaagaaaggtagttcct |
85 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21946274 |
aaacaaatgcctcagctccctcatatgtctcgatgatccaagtagatacaacaagaaacgtagttcct |
21946207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 177 - 231
Target Start/End: Complemental strand, 21946200 - 21946146
Alignment:
| Q |
177 |
atccactgcagcctccacacatcagtttatgcacgttcaacatgtgtcttcgcat |
231 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| ||||||||||||||| |||| |
|
|
| T |
21946200 |
atccactgcagcctccacacctcggtttatgcacattcaacatgtgtctttgcat |
21946146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University