View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7345_low_10 (Length: 236)

Name: NF7345_low_10
Description: NF7345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7345_low_10
NF7345_low_10
[»] chr4 (1 HSPs)
chr4 (103-217)||(21227445-21227559)


Alignment Details
Target: chr4 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 103 - 217
Target Start/End: Complemental strand, 21227559 - 21227445
Alignment:
103 cctctttctaacctagcacttatgcacaagcttctaaatatgatcattggctacgccatagacactgcactacaagctcttcaattaaacagcatttgag 202  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||||    
21227559 cctctttctaacctagcacttatgcacaagattctaaatatgatcattggctaggccatagacactgaactacaagctcttcaattaaacaccatttgag 21227460  T
203 tgcttacttaagtca 217  Q
    |||||||||||||||    
21227459 tgcttacttaagtca 21227445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University