View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7345_low_5 (Length: 259)
Name: NF7345_low_5
Description: NF7345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7345_low_5 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 10 - 235
Target Start/End: Complemental strand, 33785633 - 33785407
Alignment:
| Q |
10 |
agaacctgtgatatattctggtagcatacgtgacaatattttgtttggaaaacaagatgcaagtgaaaatgaagttgttgaggctgctaggtctgcaaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33785633 |
agaacctgtgatatattctggtagcatacgtgacaatattttgtttggaaaacaagatgcaagtgaaaatgaagttgttgaggctgctaggtctgcaaat |
33785534 |
T |
 |
| Q |
110 |
gctcatgacttcatatcgtaagtttcctctttatgca--nnnnnnnnattatcaagaatcgaactcggtatcctagagtttacaacactcacacactgcg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33785533 |
gctcatgacttcatatcgtaagtttcctctttatgcattttttttttattatcaagaatcgaactcggtatcctagagtttacaacactcacacactgcg |
33785434 |
T |
 |
| Q |
208 |
taccgatcacttgcgtttgaacctgata |
235 |
Q |
| |
|
|| ||||||||||||||||||||||||| |
|
|
| T |
33785433 |
ta-cgatcacttgcgtttgaacctgata |
33785407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University