View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7347_high_25 (Length: 401)

Name: NF7347_high_25
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7347_high_25
NF7347_high_25
[»] chr5 (3 HSPs)
chr5 (5-53)||(43195384-43195432)
chr5 (199-242)||(43195192-43195235)
chr5 (340-384)||(43195050-43195094)


Alignment Details
Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 53
Target Start/End: Complemental strand, 43195432 - 43195384
Alignment:
5 ctttttcgacagcaattatagtagtttaattaaaatattagatacgaat 53  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
43195432 ctttttcgacagcaattatagtagtttaattaaaatattagatacgaat 43195384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 199 - 242
Target Start/End: Complemental strand, 43195235 - 43195192
Alignment:
199 tccctttaaaaagggtgaaaaagtctcaacattacatcactttt 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
43195235 tccctttaaaaagggtgaaaaagtctcaacattacatcactttt 43195192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 384
Target Start/End: Complemental strand, 43195094 - 43195050
Alignment:
340 ctcaccaccttccttgtgacgctgacggtgtatgcatggtctgca 384  Q
    |||||||||||||||||||||||||||||||||||||||| ||||    
43195094 ctcaccaccttccttgtgacgctgacggtgtatgcatggtttgca 43195050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University