View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_high_25 (Length: 401)
Name: NF7347_high_25
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_high_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 53
Target Start/End: Complemental strand, 43195432 - 43195384
Alignment:
| Q |
5 |
ctttttcgacagcaattatagtagtttaattaaaatattagatacgaat |
53 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195432 |
ctttttcgacagcaattatagtagtttaattaaaatattagatacgaat |
43195384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 199 - 242
Target Start/End: Complemental strand, 43195235 - 43195192
Alignment:
| Q |
199 |
tccctttaaaaagggtgaaaaagtctcaacattacatcactttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43195235 |
tccctttaaaaagggtgaaaaagtctcaacattacatcactttt |
43195192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 340 - 384
Target Start/End: Complemental strand, 43195094 - 43195050
Alignment:
| Q |
340 |
ctcaccaccttccttgtgacgctgacggtgtatgcatggtctgca |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43195094 |
ctcaccaccttccttgtgacgctgacggtgtatgcatggtttgca |
43195050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University