View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_high_34 (Length: 324)
Name: NF7347_high_34
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_high_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 6e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 76 - 184
Target Start/End: Complemental strand, 30709366 - 30709255
Alignment:
| Q |
76 |
gaactcaatttcaggaccatgattc-aatcatcatatatttgaaggcatattcaccaca--acccaagtagaaaactatcaaacagtttgcacaatatga |
172 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||||||| ||||||||||| |||||| |||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
30709366 |
gaactcaatttcagaaccatgattcgaatcatcatatattcgaaggcatattgaccacacaacccaagtagaaaactatcaaacattttgcacaagatga |
30709267 |
T |
 |
| Q |
173 |
aataataataaa |
184 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
30709266 |
aataatcataaa |
30709255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 263 - 305
Target Start/End: Complemental strand, 30709033 - 30708991
Alignment:
| Q |
263 |
cacataccaggttcatcagtgccatcagaacagtcacagaaat |
305 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
30709033 |
cacataccaggttcatcagtaccatcagaacagtcacagaaat |
30708991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University