View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_high_46 (Length: 247)
Name: NF7347_high_46
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_high_46 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 5984415 - 5984188
Alignment:
| Q |
1 |
gtctattatgagctttgtagcacctacacttctaattgaaggagtttccggtgtccgatatgtgcatgtgataaaattattaccgacgtgtcagtgtcgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5984415 |
gtctattatgagctttgtagcacctacacttctaattgaaggagttgccggtgtccgatatatgcatgtgataaaattattaccgacgtgtcagtgtcgt |
5984316 |
T |
 |
| Q |
101 |
gtccagtgtctgcctcaatgcttcatagatcatgagtaataaaaacattaaaacagtgcaaccaggttctaaggaaaaggtttcaaagattttcttacca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5984315 |
gtccagtgtctgcctcaatgcttcatagatcatgagtaataaaaacattaaaacagcgcaaccaggttctaaggaaa-------aaagattttcttacca |
5984223 |
T |
 |
| Q |
201 |
ttaaagtgacagatgtatgcagtcatcagcacagg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5984222 |
ttaaagtgacagatgtatgcagtcatcagcacagg |
5984188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 58
Target Start/End: Original strand, 28503107 - 28503151
Alignment:
| Q |
14 |
tttgtagcacctacacttctaattgaaggagtttccggtgtccga |
58 |
Q |
| |
|
||||||||||| | ||||||||||||||| || |||||||||||| |
|
|
| T |
28503107 |
tttgtagcaccaatacttctaattgaaggtgtgtccggtgtccga |
28503151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 58
Target Start/End: Original strand, 29815512 - 29815556
Alignment:
| Q |
14 |
tttgtagcacctacacttctaattgaaggagtttccggtgtccga |
58 |
Q |
| |
|
||||||||||| | ||||||||||||||| || |||||||||||| |
|
|
| T |
29815512 |
tttgtagcaccaatacttctaattgaaggtgtgtccggtgtccga |
29815556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University