View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_low_38 (Length: 337)
Name: NF7347_low_38
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 13 - 323
Target Start/End: Complemental strand, 33963984 - 33963678
Alignment:
| Q |
13 |
acgtgtgactccggaacacgataaccttcttacaagtga---attccaagctaatgaatttcgacaggccttgtttagcatgcatgcagatacagcttca |
109 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33963984 |
acgtgcgactccggaacacaataaccttcttacaagtgatcaattccaagctaatgaatttcgacaggccttgtttagcat--------atacagcttca |
33963893 |
T |
|
| Q |
110 |
ggctccgacaaattaattggatcaagcaacactgcattt-gaatgaaactaacatagtgttgatactgaaggttagaatctgacatctatgaaggattta |
208 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33963892 |
ggccccgacaaattaattggatcaagcaacactgcattttgaatgaaaccaacatagttttgatactgaaggttagaatctgacatctatgaaggattta |
33963793 |
T |
|
| Q |
209 |
agaccaatatccctgtgcaaaaacatgtccataccctttccttattttattgttagatccaattgtagggaagttattgaatttcgtgagcgccatttct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33963792 |
agaccaatatccctgtgcaaaaacatgtccataccctttccttattttattgttagatccaattgtagggaagttattgaatttcgtgagcgccatttct |
33963693 |
T |
|
| Q |
309 |
aaatactttgacaca |
323 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
33963692 |
aaatacttttacaca |
33963678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University