View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_low_49 (Length: 270)
Name: NF7347_low_49
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_low_49 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 14498279 - 14498547
Alignment:
| Q |
1 |
ttttgcagctttgtaaagggaacggatcctctctagtggaatttttactcgagtgtccagtgcatatccttatctttaagttctcccaaatccacatgcg |
100 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14498279 |
ttttgcagttttgtaaagggagcggatcctctc-agtggaatttttactcgagtgtccagtgcacatccttatctttaagttctcccaaatccacatgcg |
14498377 |
T |
 |
| Q |
101 |
gtattaaatatggatggttgagattccactgcacacacattacacgggagaggatccctatccgtattttgaagaggcaagctggtgaactttatctgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14498378 |
gtattaaatatggatggttgagattccactgcacacacattacacgggagaggatccctacccgtattttgaagaggcaagctggtgaactttatctgca |
14498477 |
T |
 |
| Q |
201 |
gttttgattttgagactaagctaagtagtctctcaattaagttggatggtgattttgtagacaattaagt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14498478 |
gttttgattttgagactaagctaagtagtctctcaattaagttggacggtgattttgtagacaattaagt |
14498547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 14499951 - 14500219
Alignment:
| Q |
1 |
ttttgcagctttgtaaagggaacggatcctctctagtggaatttttactcgagtgtccagtgcatatccttatctttaagttctcccaaatccacatgcg |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
14499951 |
ttttgcagctttgtaaagggagcggatcctctc-agtggaatttttactcgagtgtccagtgcacatccttatctttaagttctcccaaatccacatgcg |
14500049 |
T |
 |
| Q |
101 |
gtattaaatatggatggttgagattccactgcacacacattacacgggagaggatccctatccgtattttgaagaggcaagctggtgaactttatctgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14500050 |
gtattaaatatggatggttgagattccactgcacacacattacacgggagaggatccctacccatattttgaagaggcaagctggtgaactttatttgca |
14500149 |
T |
 |
| Q |
201 |
gttttgattttgagactaagctaagtagtctctcaattaagttggatggtgattttgtagacaattaagt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14500150 |
gttttgattttgagactaagctaagtagtctctcaattaagttggatggtgattttgtagacaattaagt |
14500219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University