View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_low_56 (Length: 245)
Name: NF7347_low_56
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 35702457 - 35702230
Alignment:
| Q |
1 |
tttgagaaaatcaaca---acaattctcaattttgaagattattacaaaatccccaaatcaaaaatttccaaaatcacaaaacattgattcattacctgt |
97 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35702457 |
tttgagaaaatcaacaacaacaattctcaattttaaagaatattacaaaatccccaaatcaaaaaattccaaaatcacaaaacattgattcattacctgt |
35702358 |
T |
|
| Q |
98 |
gtatgtggtggtcggtggagagcgcggcggagagattccacaggcagaagcaaattcgcgcgcgaggaagaaaatgggaaatgcgacgcgcgagttcaat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35702357 |
gtatgtggtggtcggtggagagcgcggcggagagattccacaggcagaagcaaattcgcgcgcgaggaagaaaatgggaaatgcgacgcgcgagttcaaa |
35702258 |
T |
|
| Q |
198 |
gtgaaaagcgttaattgaaatgaagtgt |
225 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
35702257 |
gtgaaaagtgttaattgaaatgaagtgt |
35702230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University