View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_low_57 (Length: 240)
Name: NF7347_low_57
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 20 - 223
Target Start/End: Original strand, 43199133 - 43199340
Alignment:
| Q |
20 |
atatagaaaaagaaaggtctaa---aacaaatagaagaatgtgcaagtctttatcttt-atatcatgtatgtatatgtatttcttgcttatacgactaag |
115 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43199133 |
atatagaaaaagaaaggtctaataaaacaaatagaagaatgtgcaagtctttatcttttatattatgtatgtatatgtatttcttgcttatacgactaag |
43199232 |
T |
|
| Q |
116 |
atttcttcttcccgccaattctgggtactagctgaaatcctcacgccaaggaaattgatatcactcactctttagaaatttaaatactagttttttcaat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43199233 |
atttcttcttcccgccaattctgggtactagctgaaatcctcacgccaaggaaattgatatcactcactctttagaaatttaaatactagttttctcaat |
43199332 |
T |
|
| Q |
216 |
ggagtatg |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
43199333 |
ggagtatg |
43199340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University