View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_low_61 (Length: 233)
Name: NF7347_low_61
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 17 - 130
Target Start/End: Original strand, 24597403 - 24597516
Alignment:
| Q |
17 |
atgtgaacagtgttcgggtggaaggggtggagaatgttcacagggttgtatttaatcactttcagtcacattttcaggtggttaacattgatcgacttgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24597403 |
atgtgaacagtgttcgggtggaaggggtggagaatgttcacagtgttgtatttaatcactttcagtcacattttcaggtggttaacattgatcgacttgg |
24597502 |
T |
|
| Q |
117 |
agtagaaaatttta |
130 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
24597503 |
agtagaaagtttta |
24597516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University