View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7347_low_64 (Length: 221)
Name: NF7347_low_64
Description: NF7347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7347_low_64 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 49705404 - 49705216
Alignment:
| Q |
20 |
aaaaggagtaaatatataatctgaaattgaaatagtgaaagataccgcgaatacagaaaacgacgttgaagaattcccgggaacacgctgacaatcaatc |
119 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
49705404 |
aaaaggagtaaataaataatctgaaactgaaatagtgaaatataccgcgaatacagaaaacgacgttgaagagttcccgggaacgcgctgacaatcaatc |
49705305 |
T |
 |
| Q |
120 |
ttaattaaaaagtaatcctcccctttcttagattgagcagcttgaccaattcttacagtaggcttctccatcttctcacttttcatctc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49705304 |
ttaattaaaaagtaatcctcccctttcttagattgggcagcttgaccaattcttacagtaggcttctccatcttctcacttttcatctc |
49705216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University