View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7349_low_14 (Length: 258)
Name: NF7349_low_14
Description: NF7349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7349_low_14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 258
Target Start/End: Original strand, 34384628 - 34384885
Alignment:
| Q |
1 |
ggttgttgcaagaattgttggagcctgcacttctgaactttacattttccttaatgtctattagccttgttgcaaacctaataaatagtaaaagatgtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384628 |
ggttgttgcaagaattgttggagcctgcacttctgaactttacattttccttaatgtctattagccttgttgcaaacctaataaatagtaaaagatgtcg |
34384727 |
T |
|
| Q |
101 |
gcagaggactaagaaatggaagggaaaaaatgtgatctcaattgaaatgagagacttactgggttccttcaactattggttcaccttctttgaaaaattc |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384728 |
gcagaggactaagaaattgaagggaaaaaatgtgatctcaattgtaatgagagacttactgggttccttcaactattggttcaccttctttgaaaaattc |
34384827 |
T |
|
| Q |
201 |
attgtgcgtctcttgccatccatcatcaacgatgataaactttggtgtaaaacctcca |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34384828 |
attgtgcgtctcttgccatccatcatcaacgatgataaactttggtgtaaaacctcca |
34384885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University