View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7349_low_15 (Length: 253)
Name: NF7349_low_15
Description: NF7349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7349_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 41765487 - 41765611
Alignment:
| Q |
1 |
ttccctcacacggaacattcagatcatgaaccggagtaatcgtaccgcccggcattggcctgttaactccagtattcctctcaattggacctagcactgc |
100 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41765487 |
ttccctcatacggaacattaagatcatgaacaggagtaataggaccgcccggcattggcctgttaactccagtattcctctcaattggacctagcactgc |
41765586 |
T |
|
| Q |
101 |
accagctttaatacacttcgattcc |
125 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
41765587 |
accagcttgaatacacttcgattcc |
41765611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University