View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7349_low_17 (Length: 242)
Name: NF7349_low_17
Description: NF7349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7349_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 103 - 227
Target Start/End: Complemental strand, 7409687 - 7409563
Alignment:
| Q |
103 |
agtataatttgacccaaagttcatacatcttgagatgttttaaaaattaaatacgtcccctttatttaaataagaaaaacaaactattacagatatatgc |
202 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7409687 |
agtataatttgacccaaaattcatacatcttgagatgttttaaaaattaaatacgtcccctttatttaaataagaaaaacaaactattacagatatatgc |
7409588 |
T |
 |
| Q |
203 |
taagagtttttcatacatagatact |
227 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
7409587 |
taagagtttttcatgcatagatact |
7409563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University