View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7349_low_19 (Length: 222)
Name: NF7349_low_19
Description: NF7349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7349_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 61 - 206
Target Start/End: Original strand, 44408157 - 44408302
Alignment:
| Q |
61 |
tttacattaatagattatgaatgattttgaactttgcatgtgagttgttttgttctgcatagtctggatccacaacatccctttcgtcagatcttaaggc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44408157 |
tttacattaatagattatgaatgattttgaactttgcatgtgagttgttttgttctgcatagtctggatccacaacatccctttcgtcagatcttaaggc |
44408256 |
T |
 |
| Q |
161 |
acatgattttgagataagttattatctaattacgaagcatatatgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44408257 |
acatgattttgagataagttattatctaattacgaagcatatatgt |
44408302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University