View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7349_low_7 (Length: 444)
Name: NF7349_low_7
Description: NF7349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7349_low_7 |
 | |
|
| [»] scaffold0049 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0049 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 14 - 426
Target Start/End: Original strand, 56167 - 56579
Alignment:
| Q |
14 |
tggacatcagtaactggtttgctttcttctaaaggtgtcaactatgaaggtgactagctagaagaagtttcttctatcatatcatagtactaactaagtt |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
56167 |
tggacttcagtaactggtttgctttcttctaaaggtgtcaactatgaaggtgactagctagaagaagtttcttttatcatatcatagtactaacaaagtt |
56266 |
T |
|
| Q |
114 |
taatactaataaatttgaagtttatatatttatctttgttgaacatgcagttcaagctttaataggatttaagaattctctggtagatcctcattctgct |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
56267 |
taatactaataaatttgaagtttatatatttatctttgttgaacatgcagttcaagctttaataggaattaagaattctctggtagatcctcattctgct |
56366 |
T |
|
| Q |
214 |
ttaaataattgggatgctgagtctgttgatccttgcaactgggctatgatcacttgttcttctgatcgtttcgtcgttgctctgtgagtcaaagttacaa |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56367 |
ttaaataattgggatgctgagtctgttgatccttgcaactgggctatgatcacttgttcttctgatcgtttcgtcgttgctctgtgagtcaaagttacaa |
56466 |
T |
|
| Q |
314 |
ctaacaaaactatacnnnnnnnntacttattctttaggattttattttataagttcttgtttcatttttgtcagtggaattccaagccagaatatatctg |
413 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
56467 |
ctaacaaaactatacaaaaaaaatacttattctttaggattttattttataagttcttgtttcatttttgtcagtggaattccaagccagaatatatcag |
56566 |
T |
|
| Q |
414 |
gtacactctcatc |
426 |
Q |
| |
|
||||||||||||| |
|
|
| T |
56567 |
gtacactctcatc |
56579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University