View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_high_24 (Length: 309)
Name: NF7350_high_24
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_high_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 18 - 293
Target Start/End: Original strand, 25897353 - 25897628
Alignment:
| Q |
18 |
cccttatgatattgctacggattctgttcttgcaaggtgttgtggtgaaaggatagttgatgaaatgtgagtatttggaaaggttgacatggccagaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25897353 |
cccttatgatattgctacggattctgttcttgcaaggtgttgtggtgaaaggatagttgatgaaatgtgagtatttggaaaggttgacatggccagaagg |
25897452 |
T |
|
| Q |
118 |
tttaactgctgcagcctctctacgtgttagagaggagggaatggtagttgaggtgactgagaaagcctccattggtatggaagtatgaactctttggtgg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25897453 |
tttaactgctgcagcctctctacgtgttagagaggagggaatggtagttgaggtgactgagaaagcctccattggtatggaagtatgaactctttggtgg |
25897552 |
T |
|
| Q |
218 |
gaaagtatatatgaagtgttgaatagttttgatcatactatgttaaatttatgttgttgttatgttattatattat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25897553 |
gaaagtatatatgaagtgttgaatagttttgatcatactatgttaaatttatgttgttgttatgttattatattat |
25897628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University