View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_high_34 (Length: 253)
Name: NF7350_high_34
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_high_34 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 253
Target Start/End: Complemental strand, 3804644 - 3804401
Alignment:
| Q |
10 |
aagaatatgaaatagtaactaggtttaattaaacgcacttttgacctcctatatttgccatggtagcattttacagagggtggtgatgcaaaccatgctt |
109 |
Q |
| |
|
||||| |||||||||||| |||| |||||||||||||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
3804644 |
aagaacatgaaatagtaattaggcttaattaaacgcacttttgaccccctatgtttgccatggtagcaatttacagagggtggtgatgcaaaccatgctt |
3804545 |
T |
|
| Q |
110 |
ttcatgaggttattagtggtggagaaatggaacaccgtcgttttgtgtggatgaggaaggaagtacgcaaggatgatgaactcgttgagcnnnnnnngaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3804544 |
ttcatgaggttattagtggtggagaaatggaacaccgtcgttttgtgtggatgaggaaggaagtacgcaaggatgatgaactcgttgagcaaaaagagaa |
3804445 |
T |
|
| Q |
210 |
gaaagttgatgatgagcgtttgatgagaaagaatcgccatcgcc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3804444 |
gaaagttgatgatgagcgtttgatgagaaagaatcgccatcgcc |
3804401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 85 - 151
Target Start/End: Original strand, 26913363 - 26913429
Alignment:
| Q |
85 |
gagggtggtgatgcaaaccatgcttttcatgaggttattagtggtggagaaatggaacaccgtcgtt |
151 |
Q |
| |
|
||||||| |||| ||||| ||| ||||||||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
26913363 |
gagggtgatgattcaaacaatgtttttcatgaggttgtaagtggtggtgaaatggaacaccgtcgtt |
26913429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University