View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_27 (Length: 328)
Name: NF7350_low_27
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 312
Target Start/End: Complemental strand, 36402412 - 36402133
Alignment:
| Q |
22 |
ttcactattaattttttattcttaaatggatttatatcatgaatatattagtatactaagataaaaggtaaagaattactttcttctaatggttgttgag |
121 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36402412 |
ttcactattaatttattattcttaaatggatttatatcatg----------------aagataaaaggtaaagaattactttcttgtaatggttgttgag |
36402329 |
T |
 |
| Q |
122 |
gaacctaactgaggtgtaggggccgggaaactagctagttagtcttgtttccttcattattgaatgaattctataaataatagagtcagcagtacccttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402328 |
gaacctaactgaggtgtaggggccgggaaactagctagttagtattgtttccttcattattgaatgaattctataaataatagagtcagcagtacccttt |
36402229 |
T |
 |
| Q |
222 |
atatatatctctgttgtatttacattgcatgcattg-----gtagttgctagagcttgattgtaccaaaggtttaacgtctaaatcatcacagatt |
312 |
Q |
| |
|
|||| | |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36402228 |
atatctctctctgttgtatttgcattgcatgcattggtacagtagttgctagagcttgattgtaccaaaggtttaacgtctaaatcatcacagatt |
36402133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University