View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_28 (Length: 326)
Name: NF7350_low_28
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 13 - 310
Target Start/End: Original strand, 52816702 - 52816997
Alignment:
| Q |
13 |
aatatcatagttaatactcaacactctttttaaagtataaaacccaaattttatcgtagtatataggttacgactttaaaatatctacagtaactaaaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| || | | | |
|
|
| T |
52816702 |
aatatcatagttaatactcaacactctttttaaagtataaaacccaaattttattgtagtatataggttacgactttaaaataacta----aattggaca |
52816797 |
T |
 |
| Q |
113 |
agtataa--acctcaagatgaataacaaaggaggttataattttatatagtaactaaaaaagttattagcattacttgcaccaaactaaatactctgttg |
210 |
Q |
| |
|
| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52816798 |
tatttcattacctcaagatgaataacaaaggaggttataattttatatagtaactaaaaaagttattagcattacttgcaccaaactaaatactctgttg |
52816897 |
T |
 |
| Q |
211 |
tttaaatgtgcagatgatcgagctagataaagatgagttgaggttaacttacccgcacggactctccatgttattatagcatccagttgtgggttatatt |
310 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52816898 |
tttagatgtgcagatggtcgagctagataaagatgagttgaggttaacttacccgcacggactctccatgttattatagcatccagttgtgggttatatt |
52816997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University