View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_34 (Length: 301)
Name: NF7350_low_34
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 51 - 171
Target Start/End: Complemental strand, 29287225 - 29287105
Alignment:
| Q |
51 |
gtttatggcatgtgcaatgtgttatcaaagttcatatatgaaacaatacttaattttatgaaaattttcaaacttaaatgcagtagcttaaatttgtccc |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29287225 |
gtttatggcatgtgcaatgtgttatcaaagttcatatatgaaacaatatttaattttatgaaaattttcaaacttaaatgcagtagcttaaatttgtccc |
29287126 |
T |
|
| Q |
151 |
ttgttcaatttagattctcta |
171 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29287125 |
ttgttcaatttagattctcta |
29287105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 172 - 288
Target Start/End: Complemental strand, 29284859 - 29284743
Alignment:
| Q |
172 |
gttgcaattgtgcgatttaaaccttatttttacaccttttctcatttactagcctctcgtgcacattttgactaagaaaatagacttgtccattatttcc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29284859 |
gttgcaattgtgcgatttaaaccttatttttaccccttttctcatttactagcctctcgtgcacattttgactaagaaaatagacatgtccattatttcc |
29284760 |
T |
|
| Q |
272 |
aggtgcttgattatatt |
288 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
29284759 |
aggtgcttgattatatt |
29284743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University