View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_37 (Length: 287)
Name: NF7350_low_37
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_37 |
 | |
|
| [»] scaffold0272 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0272 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 14 - 173
Target Start/End: Original strand, 5665 - 5824
Alignment:
| Q |
14 |
tgaaataattggagtctcttagttttttcaatcttttgttgaataaaattggttgtataaggatatgcagcttcatgatgcaaaaaatgaatattaaact |
113 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
5665 |
tgaaataattggagtctctaaattttttcaatcttttgttgaataaaattggttgtataaggatatgcagcttcatgatacaaaaaatgaatattgaact |
5764 |
T |
|
| Q |
114 |
gatcagagttattgatttaataataattaatttgttgtacgaaataaagttgagtacgtt |
173 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||| ||||| |||||||||||||| |
|
|
| T |
5765 |
gatcagagtaatggatttaataataattaatatgttgtatgaaatcaagttgagtacgtt |
5824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 174 - 209
Target Start/End: Original strand, 5840 - 5875
Alignment:
| Q |
174 |
ttcagtcttaattatagttatagacaaaaatgttaa |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5840 |
ttcagtcttaattatagttatggacaaaaatgttaa |
5875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 232 - 270
Target Start/End: Complemental strand, 45414339 - 45414301
Alignment:
| Q |
232 |
caacggttgttaacaaccgatggggtaaaaacgtcattt |
270 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
45414339 |
caacggttgttaactaccgctggggtaaaaacgtcattt |
45414301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University