View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_39 (Length: 271)
Name: NF7350_low_39
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 70 - 259
Target Start/End: Original strand, 43266040 - 43266229
Alignment:
| Q |
70 |
taatggatagagaagaacctagtttggtgaaatcagcagaagcaagagcatcagcatagtatttgtcgttgtaacgaacagggaaaagagcaagattaag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43266040 |
taatggatagagaagaacctagtttggtgaaatcagcagaagcaagagcatcagcatagtatttgtcgttgtaacgaacagggaaaagagcaagattaag |
43266139 |
T |
 |
| Q |
170 |
tttcttgagttgcataatgttcttgtctcttactccatctaatgagattgatacttcacgaccagctcccattgattctacttctattca |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43266140 |
tttcttgagttgcataatgttcttgtctcttacaccatctaatgagattgatacttcacgaccagctcccattgattctacttctattca |
43266229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University