View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7350_low_48 (Length: 250)

Name: NF7350_low_48
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7350_low_48
NF7350_low_48
[»] chr1 (2 HSPs)
chr1 (58-243)||(52816436-52816621)
chr1 (1-60)||(52816648-52816707)


Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 58 - 243
Target Start/End: Complemental strand, 52816621 - 52816436
Alignment:
58 cttttagtagacttgattgctttaaccaccacttgcttggtgagtcagaagcagactcagcacccacagttgtttccaataaataaatgatagttataga 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52816621 cttttagtagacttgattgctttaaccaccacttgcttggtgagtcagaagcagactcagcacccacagttgtttccaataaataaatgatagttataga 52816522  T
158 ttttgggagacaattggggttaacaacacctggactaaaggaagacattctcccactgaacctacccacgaccaaatttcttctca 243  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
52816521 ttttgggagacaattggggttaacaacacctgcactaaaggaagacattctcccactgaacctacccacgaccaaatttcttctca 52816436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 52816707 - 52816648
Alignment:
1 gatatttttggtatcaagttagatatgatttagcattgnnnnnnnggtgtccagagactt 60  Q
    ||||||||||||||||||||||||||||||||||||||       |||||||||||||||    
52816707 gatatttttggtatcaagttagatatgatttagcattgtttttttggtgtccagagactt 52816648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University