View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_48 (Length: 250)
Name: NF7350_low_48
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 58 - 243
Target Start/End: Complemental strand, 52816621 - 52816436
Alignment:
| Q |
58 |
cttttagtagacttgattgctttaaccaccacttgcttggtgagtcagaagcagactcagcacccacagttgtttccaataaataaatgatagttataga |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52816621 |
cttttagtagacttgattgctttaaccaccacttgcttggtgagtcagaagcagactcagcacccacagttgtttccaataaataaatgatagttataga |
52816522 |
T |
 |
| Q |
158 |
ttttgggagacaattggggttaacaacacctggactaaaggaagacattctcccactgaacctacccacgaccaaatttcttctca |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52816521 |
ttttgggagacaattggggttaacaacacctgcactaaaggaagacattctcccactgaacctacccacgaccaaatttcttctca |
52816436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 52816707 - 52816648
Alignment:
| Q |
1 |
gatatttttggtatcaagttagatatgatttagcattgnnnnnnnggtgtccagagactt |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52816707 |
gatatttttggtatcaagttagatatgatttagcattgtttttttggtgtccagagactt |
52816648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University