View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_50 (Length: 241)
Name: NF7350_low_50
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 46527506 - 46527284
Alignment:
| Q |
1 |
attgatagcttcttgtggagtttccacnnnnnnnccactgagaagctcatgtaactgatgcatactaacatgagctaaaaacttgattgcaacttcaaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46527506 |
attgatagcttcttgtggagtttccactttttttccactgagaagctcatgtaactgatgcatactaacatgagctaaaaacttgattgcaacttcaaat |
46527407 |
T |
|
| Q |
101 |
tttctttccctgaacacacaaatttacagcttcatatttgttacaaaatccaaaaatttaaagaaaatttacatggttttttcttgaataaatcaatcac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46527406 |
tttctttccctgaacacacaaatttacaacttcatatttgttacaaaatccaaaaatttaaagaaaatttacatggttttttcttgaataaatcaatcac |
46527307 |
T |
|
| Q |
201 |
cttgtagtaccaaaaccctcatc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
46527306 |
cttgtagtaccaaaaccctcatc |
46527284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 7e-30; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 77 - 204
Target Start/End: Original strand, 43030968 - 43031095
Alignment:
| Q |
77 |
aaaaacttgattgcaacttcaaattttctttccctgaa--cacacaaatttacagcttcatatttgttacaaaatccaaaaatttaaagaaaatttacat |
174 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||| || |||||||||||||| || ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
43030968 |
aaaaactcgattgcaacttcaaattctctttcccctaaaacacacaaatttacaact-catatttgttacaaaatccaaaagtttaaagaaaatttacat |
43031066 |
T |
|
| Q |
175 |
ggttttttcttgaataaatcaatcaccttg |
204 |
Q |
| |
|
||| |||| ||||| |||||||||||||| |
|
|
| T |
43031067 |
ggtatttttttgaa-caatcaatcaccttg |
43031095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University