View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_56 (Length: 239)
Name: NF7350_low_56
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 63 - 223
Target Start/End: Complemental strand, 47469719 - 47469559
Alignment:
| Q |
63 |
gcataacaaaaatgatgtaacataaacattttaacaattctcaggcactaaaggacataccacgagatcaaattcagattgctacaaagtttgggattgt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469719 |
gcataacaaaaatgatgtaacataaacattttaacaattctcaggcacttaaggacataccacgagatcaaattcagattgctacaaagtttgggattgt |
47469620 |
T |
|
| Q |
163 |
caaaatggaatctggtaacgttgtagtaaatggtagtcctgaatatgttcgatcatgttgt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469619 |
caaaatggaatctggtaacgttgtagtaaatggtagtcctgaatatgttcgatcatgttgt |
47469559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 47469780 - 47469744
Alignment:
| Q |
1 |
aagtttttgtcggaaaggtactactttcattcacata |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47469780 |
aagtttttgtcggaaaggtactactttcattcacata |
47469744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University