View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_62 (Length: 228)
Name: NF7350_low_62
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_62 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 6 - 228
Target Start/End: Original strand, 12186552 - 12186775
Alignment:
| Q |
6 |
aatatctaggtggaattgttcaacaaatagaaggttcattagaaaacgaatggcttccttgggctgatgggaagcacagtaaccatgaatgatatacaag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12186552 |
aatatctaggtggaattgttcaacaaatagaaggttcattagaaaacgaatggcttccttgggctgatgggaagcaaagtaaccatgaatgatatacaag |
12186651 |
T |
 |
| Q |
106 |
tatatgtaacagtttggaaggtgtcaagaggatataatttcagcgcaaagatcaagagttgtgacaatatgatttgaccataaaagccatatg-aaaaaa |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
12186652 |
tatatgtaatagtttggaaggtgtcaagaggatataatttcggcgtaaagatcaagagttgtgacaatatgatttggccataaaagccatatgaaaaaaa |
12186751 |
T |
 |
| Q |
205 |
ctgtcaattacagtctcgtacatt |
228 |
Q |
| |
|
| |||||| ||||||||||||||| |
|
|
| T |
12186752 |
ccgtcaatgacagtctcgtacatt |
12186775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University