View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7350_low_63 (Length: 223)
Name: NF7350_low_63
Description: NF7350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7350_low_63 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 21567386 - 21567188
Alignment:
| Q |
13 |
ctgtgaaaagctaaaatatgtgagtgtggaagatatcaaacaagagtcactggctctacataagatgattgttgatgagggtggttgttatgagaaaagt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21567386 |
ctgtgaaaagctaaaatatgtgagtgtggaagatatcaaacaagagtcactggctctacataagatgattgttgatgagggtggttgttatgagaaaagt |
21567287 |
T |
|
| Q |
113 |
gcgcagaggttgtcaatggtgctgnnnnnnnttgaagagtttttgttgaaggaatctgaaaacaatggaggtggttgttttgagaaaagcacacaggtt |
211 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21567286 |
gcgcagaggttgtcaatggtgctgaaaaaaattgaagagtttttgttgaaggaatctgaaaacaatggaggtggttgttttgagaaaagcacacaggtt |
21567188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University