View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7352_low_4 (Length: 277)
Name: NF7352_low_4
Description: NF7352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7352_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 825092 - 824902
Alignment:
| Q |
1 |
atgaatagagctacagggatatcgccaattacactacatacccatttttgaatcatccactcattctgtagtttattacacaactttgacaagtttgtgg |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
825092 |
atgaatagagctacagggatatcaccaattacactacatacccatttttgaatcgtccactcattctgtagtttattacacaactttgacaagtttgtgg |
824993 |
T |
 |
| Q |
101 |
tttttcccaattgctttagtgtaggaacttacaagtgcacatgctagtcctagctgctatttggcaactcaacaattcttaaaatcatatt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
824992 |
tttttcccaattgctttagtgtaggaacttacaagtgcacatgctagtcctagctgctatttggcaactcaacaattcttaaaatcatatt |
824902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 216 - 262
Target Start/End: Complemental strand, 824877 - 824831
Alignment:
| Q |
216 |
attgtggatgtgttgcatggggttgtgtcatgaagctcaagccaaac |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
824877 |
attgtggatgtgttgcatggggttgtgtcatgaagctcaagccaaac |
824831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University