View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7352_low_5 (Length: 250)
Name: NF7352_low_5
Description: NF7352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7352_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 2409234 - 2409318
Alignment:
| Q |
1 |
ttttcattgaaattggagttgaacattgtcgttgattttttacaaccacattctgccaactgaaatggagtagagttaacaatca |
85 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2409234 |
ttttcattgaaattggagttgaacatcgtcgttgattttttacaaccacattctgccaactgaaatggagtagaggtaacaatca |
2409318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 189 - 242
Target Start/End: Original strand, 2409422 - 2409475
Alignment:
| Q |
189 |
attagttatttttctaaaatatgatttatttattttttgcaactagtctctgct |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409422 |
attagttatttttctaaaatatgatttatttattttttgcaactagtctctgct |
2409475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University