View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7352_low_6 (Length: 215)

Name: NF7352_low_6
Description: NF7352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7352_low_6
NF7352_low_6
[»] chr3 (2 HSPs)
chr3 (22-84)||(53098594-53098656)
chr3 (136-183)||(53098714-53098761)


Alignment Details
Target: chr3 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 53098594 - 53098656
Alignment:
22 ctgagttctgactgaaaaacagcaatgagaatgagactatgtaatgtatgcggtgtttatgtt 84  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53098594 ctgagttctgactgaaaaacagcaatgagaatgagactatgtaatgtatgcggtgtttatgtt 53098656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 136 - 183
Target Start/End: Original strand, 53098714 - 53098761
Alignment:
136 caatgttgtgccttgcgttcagagaatcaggttcttttgtgagaataa 183  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||    
53098714 caatgttgtgccttgcgttcagagaatcaggttcttttgtgaaaataa 53098761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University