View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7352_low_6 (Length: 215)
Name: NF7352_low_6
Description: NF7352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7352_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 22 - 84
Target Start/End: Original strand, 53098594 - 53098656
Alignment:
| Q |
22 |
ctgagttctgactgaaaaacagcaatgagaatgagactatgtaatgtatgcggtgtttatgtt |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53098594 |
ctgagttctgactgaaaaacagcaatgagaatgagactatgtaatgtatgcggtgtttatgtt |
53098656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 136 - 183
Target Start/End: Original strand, 53098714 - 53098761
Alignment:
| Q |
136 |
caatgttgtgccttgcgttcagagaatcaggttcttttgtgagaataa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
53098714 |
caatgttgtgccttgcgttcagagaatcaggttcttttgtgaaaataa |
53098761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University