View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7353_high_1 (Length: 422)
Name: NF7353_high_1
Description: NF7353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7353_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 9e-74; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 221 - 381
Target Start/End: Complemental strand, 38900720 - 38900560
Alignment:
| Q |
221 |
cgtacaacctctcctttatccttttaactatttgtttatccaaatttattcctccaattagtcaatagcttcactctctaaattgttttaagttttgaca |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38900720 |
cgtacaacctctcctttatccttttaactatttgtttatccaaattcattcctccaattagtcaatagctccactctctaaattgttttaagttttgaca |
38900621 |
T |
 |
| Q |
321 |
taataagaatgtctttataagcattcacaataataatgaccgatgcacgagaatgtctcaa |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
38900620 |
taataagaatgtctttataagcattcacaataataatgacggataaacgagaatgtctcaa |
38900560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 17 - 146
Target Start/End: Complemental strand, 38900924 - 38900795
Alignment:
| Q |
17 |
agttggatccaaacttaatttgctccatgccagaataaaattgcatcgaagaaaaagtaatattactttgttggattggatccaaactaatgttttttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38900924 |
agttggatccaaacttaatttgctccatgccagaataaaattgcatcgaagaaaaagtaatattactttgttggattggatccaaactaatgttttttca |
38900825 |
T |
 |
| Q |
117 |
ggtgctactatgttttcctttcatgcaaca |
146 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |
|
|
| T |
38900824 |
ggtgctactaggttttcctttcatgcaaca |
38900795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 17 - 92
Target Start/End: Complemental strand, 48953881 - 48953806
Alignment:
| Q |
17 |
agttggatccaaacttaatttgctccatgccagaataaaattgcatcgaagaaaaagtaatattactttgttggat |
92 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
48953881 |
agttggatccaaacttaatttgctcgatgccacaataaaattgcatcgaagaaaaagtaattttactttgttggat |
48953806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University