View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7353_high_4 (Length: 221)
Name: NF7353_high_4
Description: NF7353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7353_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 56 - 155
Target Start/End: Original strand, 4843328 - 4843427
Alignment:
| Q |
56 |
aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatgcaggtttgtggaaatatttatggaagctaaaggcgctagagtgtgcaaaga |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4843328 |
aaagagaaaatgactagacaaaatcgataaccatctttggatgaaaatgcaggtttgtcgaaatatttatggaagctaaaggcgctagagtgtgcaaaga |
4843427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 56 - 131
Target Start/End: Complemental strand, 5194843 - 5194768
Alignment:
| Q |
56 |
aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatgcaggtttgtggaaatatttatggaagc |
131 |
Q |
| |
|
|||||| ||||| ||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5194843 |
aaagaggaaatggctagacaaagtccataaccacctttggatgagaatgcaggtttgtggaaatatttatggaagc |
5194768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 56 - 114
Target Start/End: Complemental strand, 5159260 - 5159202
Alignment:
| Q |
56 |
aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatgcaggtttgtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5159260 |
aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatacaggtttgtg |
5159202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 56 - 138
Target Start/End: Complemental strand, 5181488 - 5181406
Alignment:
| Q |
56 |
aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatgcaggtttgtggaaatatttatggaagctaaaggc |
138 |
Q |
| |
|
|||||| ||||| |||| |||| || ||||||| ||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
5181488 |
aaagaggaaatggctagtcaaagtccataaccacctttggatgagaatgcaggtttgtggaaaaatttatggaagctcaaggc |
5181406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 7 - 60
Target Start/End: Original strand, 4843237 - 4843290
Alignment:
| Q |
7 |
atggacatcaagcaacataagcgggatgtgatctttacttcaatatgataaaga |
60 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4843237 |
atggacaccaagcaacataagcgggatgtgatctttacttcaatatgataaaga |
4843290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 5172314 - 5172278
Alignment:
| Q |
174 |
ctatgttaggaaatacaaaagctcccgttcatctcac |
210 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
5172314 |
ctatgttaggaaatacaaaagctccggttcatttcac |
5172278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University