View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7353_low_5 (Length: 221)

Name: NF7353_low_5
Description: NF7353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7353_low_5
NF7353_low_5
[»] chr4 (6 HSPs)
chr4 (56-155)||(4843328-4843427)
chr4 (56-131)||(5194768-5194843)
chr4 (56-114)||(5159202-5159260)
chr4 (56-138)||(5181406-5181488)
chr4 (7-60)||(4843237-4843290)
chr4 (174-210)||(5172278-5172314)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 56 - 155
Target Start/End: Original strand, 4843328 - 4843427
Alignment:
56 aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatgcaggtttgtggaaatatttatggaagctaaaggcgctagagtgtgcaaaga 155  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
4843328 aaagagaaaatgactagacaaaatcgataaccatctttggatgaaaatgcaggtttgtcgaaatatttatggaagctaaaggcgctagagtgtgcaaaga 4843427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 56 - 131
Target Start/End: Complemental strand, 5194843 - 5194768
Alignment:
56 aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatgcaggtttgtggaaatatttatggaagc 131  Q
    |||||| ||||| ||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||    
5194843 aaagaggaaatggctagacaaagtccataaccacctttggatgagaatgcaggtttgtggaaatatttatggaagc 5194768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 56 - 114
Target Start/End: Complemental strand, 5159260 - 5159202
Alignment:
56 aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatgcaggtttgtg 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
5159260 aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatacaggtttgtg 5159202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 56 - 138
Target Start/End: Complemental strand, 5181488 - 5181406
Alignment:
56 aaagagaaaatgactagacaaaatcgataaccatctttggatgagaatgcaggtttgtggaaatatttatggaagctaaaggc 138  Q
    |||||| ||||| |||| |||| || ||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||    
5181488 aaagaggaaatggctagtcaaagtccataaccacctttggatgagaatgcaggtttgtggaaaaatttatggaagctcaaggc 5181406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 7 - 60
Target Start/End: Original strand, 4843237 - 4843290
Alignment:
7 atggacatcaagcaacataagcgggatgtgatctttacttcaatatgataaaga 60  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
4843237 atggacaccaagcaacataagcgggatgtgatctttacttcaatatgataaaga 4843290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 174 - 210
Target Start/End: Complemental strand, 5172314 - 5172278
Alignment:
174 ctatgttaggaaatacaaaagctcccgttcatctcac 210  Q
    ||||||||||||||||||||||||| |||||| ||||    
5172314 ctatgttaggaaatacaaaagctccggttcatttcac 5172278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University