View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7354_high_5 (Length: 402)
Name: NF7354_high_5
Description: NF7354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7354_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 9 - 385
Target Start/End: Original strand, 1709492 - 1709873
Alignment:
| Q |
9 |
gaagaatatggtggagtgtggttttgctgctgaagcgcttcggagatgggcggtggcggataatttagggtttcttgctcttactgctgatcctcgtttg |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1709492 |
gaagaagatggtggagtgtggttttgctgatgaagcgcttcggagatgggcggtggcggataatttagggtttcttgctcttactgctgatcctcgtttg |
1709591 |
T |
 |
| Q |
109 |
caggcttcgcttgttaaacttgcaggtattcttcatatttt-cttatgttattatttcaactagatgattagcaataattttacaattttgaacatggtt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1709592 |
caggcttcgcttgttaaacttgcaggtattcttcatatttttcttatgttattatttcaaccggatgattagcaataattttacaattttgaacatggtt |
1709691 |
T |
 |
| Q |
208 |
taaattaatcatatattcaacaaaattacccattattttttatgtaattaaccacatagaattttagtgtgcataacatctttatcaaaattacttgccc |
307 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
1709692 |
taaattaatcatatattcaactaaattacccattatttttcatgtaattaaccacatagaattttagtgtccataacatctttatcaaagttacttgccc |
1709791 |
T |
 |
| Q |
308 |
gagaatataggtggtttgaaaat----attagcttgagaatgtggacgtaggttggaaaatttctatggcaaaagaggaaag |
385 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1709792 |
gagaatataggtggtttgaaaatattaattagcttgagaatgtggacgtaggttggaaaatttctaaggcaaaagaggaaag |
1709873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University