View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7356_high_9 (Length: 252)
Name: NF7356_high_9
Description: NF7356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7356_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 18164187 - 18163946
Alignment:
| Q |
1 |
aaaactacataataatcaaacttgttgctagctctggttgttttgcttcattttcacatgcattgtatcactgctaacctaaatgaaaaattggaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18164187 |
aaaactacataataatcaaacttgttgctagctctggttgttttgcttcattttcacatgcattgtatcactgctaacctaaatgaaaaattggaataaa |
18164088 |
T |
|
| Q |
101 |
atactcggttcacttgtgagtggttaagttcagatcgtctatgaatggtgaaaaagtggataattagagaggtgactcatacacctaatgtattaagatt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18164087 |
atactcggttcacgtgtgagtggttaagttcacatcgtctatgaatggtgaaaaagtggataattagagaggtgactcatacacctaatgtattaagatt |
18163988 |
T |
|
| Q |
201 |
ttgggtggatatgtggcgtctctacctctctcttgatgtcca |
242 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
18163987 |
ttgggtggagatgtggcgtctctacctctctcttgttgtcca |
18163946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 166 - 222
Target Start/End: Original strand, 11199982 - 11200038
Alignment:
| Q |
166 |
agagaggtgactcatacacctaatgtattaagattttgggtggatatgtggcgtctc |
222 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| ||||||||||| |||||||||||| |
|
|
| T |
11199982 |
agagaggtgactcatatgcctaatgccttaaggttttgggtggagatgtggcgtctc |
11200038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 222
Target Start/End: Complemental strand, 28296126 - 28296070
Alignment:
| Q |
166 |
agagaggtgactcatacacctaatgtattaagattttgggtggatatgtggcgtctc |
222 |
Q |
| |
|
||||||||||| |||| ||||||| | ||||| ||||||||||| |||||| ||||| |
|
|
| T |
28296126 |
agagaggtgacccatatacctaatctcttaaggttttgggtggagatgtggtgtctc |
28296070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University