View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7356_low_10 (Length: 258)
Name: NF7356_low_10
Description: NF7356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7356_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 18164168 - 18164418
Alignment:
| Q |
1 |
tttgattattatgtagttttgtattgtttctttcattcctttgggtgtgcattcattatgatctgcatctagtataagcatgaaaagaaattttcaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18164168 |
tttgattattatgtagttttgtattgtttctttcattcctttgggtgtgcattcattatgatctgcatctagtataagcatgaaaagaaattttcaaaat |
18164267 |
T |
 |
| Q |
101 |
tattgcatagtaaaaggagattagcaacatctccaatgagattttatgtaatctgtgtgtatctgaatactataaattctagttttatatctaaactatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18164268 |
tattgcatagtaaaaggagattagcaacatctccaatgagattttatgtaatctgtgtgtatctgaatactataaattctagttttatatctaaactatt |
18164367 |
T |
 |
| Q |
201 |
aactcaaagtttcattgtcgccggaaagaaaaaacagatgatgtccatctc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18164368 |
aactcaaagtttcattgtcgccggaaagaaaaaacagatgatcaccatctc |
18164418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University