View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7357_low_19 (Length: 214)
Name: NF7357_low_19
Description: NF7357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7357_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 34 - 196
Target Start/End: Original strand, 6961806 - 6961967
Alignment:
| Q |
34 |
gatcgcactttggttaagttgtctcggtttannnnnnncagaggctaaaagttgcttttatttttgggatgaactaaattatgcccattcataaaacaaa |
133 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6961806 |
gatcgcactttgattaagtt-tctcggtttatttttttcagaggctaaaagttgcttttatttttgggatgaactaaattatgcccattcataaaacaaa |
6961904 |
T |
|
| Q |
134 |
cctagtagctattgtaaaacaacgtataacaatctgtgtgatccggacagactataagaaaat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
6961905 |
cctagtagctattgtaaaacaacgtataacaacctgtgtgatccggatagactataagaaaat |
6961967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University