View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7357_low_20 (Length: 212)
Name: NF7357_low_20
Description: NF7357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7357_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 40547535 - 40547346
Alignment:
| Q |
17 |
atttggtacataaaaagacgtcggtcttaggatatgacattttaatttgataggaacgttatttatactaaattttttgaagtattcttgattacatata |
116 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40547535 |
atttggtacataaatagacgtcggtcttaggatatgacattttaatttgataggaaaattatttatactaaattttttgaagtattcttgattacatata |
40547436 |
T |
 |
| Q |
117 |
tgaaaaatatgtatatactcaaatctaatcatcctttcaa-gcatgcgtacaatctcatcttttgtaattgtaattata-ttattggaga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
40547435 |
tgaaaaatatgtatatactcaaatctaataatcctttcaatgcatgcgtacaatctcatattttgtaattgtaattatatttattggaga |
40547346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University