View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7357_low_9 (Length: 244)
Name: NF7357_low_9
Description: NF7357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7357_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 43 - 233
Target Start/End: Original strand, 963146 - 963335
Alignment:
| Q |
43 |
agtagtttcacagtttgatatatggactgatcaaggtaatatttgttccaaacaggttgcagaatatggagaagaaggagaagttgttggagtgataagg |
142 |
Q |
| |
|
||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
963146 |
agtagtttcacagtttgatat-tggactaatcaatgtaatatttgttccaaacaggttgcagaatatgaagaagaaggagaagttgctggagtgataagg |
963244 |
T |
|
| Q |
143 |
ggttgtgtgaaaacagttacaagagggaattcagcttatgtaaaactagcttatgttttaggacttagagtctctcccaaacacaggttct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
963245 |
ggttgtgtgaaaacagttacaagagggaattcagcttatgtaaaactagcttatgttttaggacttagagtctctcccaaacacaggttct |
963335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University