View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7359_high_10 (Length: 409)
Name: NF7359_high_10
Description: NF7359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7359_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 2e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 18632806 - 18633035
Alignment:
| Q |
19 |
gtcttgtcagacatcgatatgtatcagacaccagacacgtcgtcaatattaagtgtcgggctacatagaccaacacatcctaaagtgtaacattttgtta |
118 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18632806 |
gtctggtcagacatcgatatgtatctgacaccagacacgtcttcaatattaagtgtcgggctacatagaccaacacatcctaaagtgtaacattttgtta |
18632905 |
T |
 |
| Q |
119 |
ttcttattgaaagtaa---tacatacctaatccaagaggatcaaaaccaaaatcaccaggaagactgcaatcaggaagaagatcaaacaattatgctgct |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
18632906 |
ttcttattgaaagtaagacgacatacctaatccaagagggtcaaaaccaaaatcaccaggaagactgcaattgggaaaaagatcaaaagattatgctgct |
18633005 |
T |
 |
| Q |
216 |
gaagttgtttagtgatgataggctttggca |
245 |
Q |
| |
|
||| |||||| |||||||||||||||||| |
|
|
| T |
18633006 |
gaatttgtttgatgatgataggctttggca |
18633035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 322 - 396
Target Start/End: Original strand, 18633113 - 18633185
Alignment:
| Q |
322 |
atagtgcgacacaagtggtagatatttgctctttatagcattttgttcagggtttgatttctggtccgtgtgtgc |
396 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
18633113 |
atagtgtgacactcgtggtagatatttgctcttta--gcatttggttcagggtttgatttctggtcggtgtgtgc |
18633185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University