View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7359_high_8 (Length: 490)

Name: NF7359_high_8
Description: NF7359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7359_high_8
NF7359_high_8
[»] chr2 (1 HSPs)
chr2 (390-444)||(11614323-11614377)


Alignment Details
Target: chr2 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 390 - 444
Target Start/End: Complemental strand, 11614377 - 11614323
Alignment:
390 aaagcattgatgtcttaggtatttaccaaagaaccacttccaggagtgaaaaata 444  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11614377 aaagcattgatgtcttaggtatttaccaaagaaccacttccaggagtgaaaaata 11614323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University