View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7359_low_21 (Length: 269)
Name: NF7359_low_21
Description: NF7359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7359_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 7012750 - 7012505
Alignment:
| Q |
18 |
aaagatggacagacattgtcaatgtaattaatcaattcatattctcacagctaatttcactttattttccactactatatggcatttcacatcttagaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012750 |
aaagatggacagacattgtcaatgtaattaatcaattcatattctcacagctaatttcaatttattttccactactatatggcatttcacatcttagaaa |
7012651 |
T |
 |
| Q |
118 |
atttgtattttttgtgtggtagtattatgagaaacttggaaagccaaggccaatgacagaagtgatgaacttcatgaaatcaaaagactatgatgatgca |
217 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012650 |
atttgtattttttgtg--gtagtattatgagaaacttggaaagccaaggccaatgacagaagtgatgaacttcatgaaatcaaaagactatgatgatgca |
7012553 |
T |
 |
| Q |
218 |
aaggattatgcaggagaatgtgaacccattgtcatcattgccaaaggc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7012552 |
aaggattatgcaggagaatgtgaacccattgtcatcattgccaaaggc |
7012505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University